Studied by 144 peoplewhat is DNA? (+ where is it stored)
DNA (deoxyribonucleic acid) is a complex molecule that contains genetic information, which is stored in the nucleus of a cell.
what is DNA made up of?
phosphate, five-carbon sugar, and an organic base.
what are the bases?
ATGC - adenine, thymine, guanine and cytosine
what are the complementary base pairs?
AT & GC - adenine + thymine & guanine + cytosine
what is a hydrogen bond?
a type of weak chemical bond between two groups of atoms - when guanine and cytosine bond, they require 3 bonds instead of 2, unlike adenine and thymine
what is a gene?
* a section of DNA that provides instructions to a cell for building a specific protein. *
(each protein plays a certain role in an organism - e.g. hemoglobin proteins transport oxygen in the blood)
genes are like packets of genetic information that can be passed between generations.
what is a nucleotide?
a sub-unit of DNA
what is a double helix?
the sugar-phosphate backbone of one nucleic chain attached to a second chain, forming a ladder-like structure
what is the nucleotide that bonds with adenine?
thymine
what is the nucleotide that bonds with guanine?
cytosine
write the complementary pairs:
ATAGCGTCAACTGTCACCCT
TATCGCAGTTGACAGTGGGA
what is mitosis?
cell division that provides cells for growth and repair
what is meiosis?
cell division that produces sex cells for reproduction
what are somatic cells?
cells (not sperm/eggs)
what are gametes?
sex cells (eggs/sperm)
what is a haploid?
cells with one set of chromosomes
what is a diploid?
cells with two sets of chromosomes
what are the phases of mitosis? (in correct order)
prophase (1), metaphase (2), anaphase (3), telophase (4), cytokinesis
what is interphase?
occurs between divisions. it is the longest part of the cycle, and the “normal life” of the cell. DNA replication happens here.
what is prophase, and what phase is it?
phase 1 - chromosomes appear, nuclear membrane disappears and spindles form
what is metaphase, and what phase is it?
phase 2 - chromosomes line up down the middle of the cell
what is anaphase, and what phase is it?
phase 3 - each pair of chromatids are separated at the centre and move to the opposite pole
what is telophase, and what phase is it?
phase 4 - nucleus membrane reforms
what is cytokinesis, and what phase is it?
trick question! cytokinesis and interphase are not technically counted as “phases” - cytokinesis is when the cytoplasm divides into two, creating two separate yet genetically identical cells
what is an acronym used to remember the order of mitosis?
P - MAT - C (prophase, metaphase, anaphase, telophase and cytokinesis)
what cell does mitosis occur in?
somatic cells
what cell does meiosis occur in?
gametes
how many times does the cell divide in mitosis?
once - creating two separate cells
how many times does the cell divide in meiosis?
twice - creating four separate cells
how many chromosomes in daughter cells? (mitosis)
46 - diploid (< cells with 2 sets of chromosomes)
how many chromosomes in daughter cells? (meiosis)
23 - haploid (< cells with 1 set of chromosomes)
what are the phases in meiosis?
interphase, prophase, metaphase, anaphase, telophase, cytokinesis (FIRST PAIR), prophase II, metaphase II, anaphase II, telophase II, cytokinesis (SECOND PAIR)
what is an acronym used to remember meiosis?
P - MAT - C x2
what is a genotype?
the genes in an organism - the dominant allele is written as a capital (e.g. purple flower - P) and the recessive allele is written as a lowercase (e.g. white flower - p)
what does homozygous mean?
a genotype of identical alleles (PP or pp)
what does heterozygous mean?
a genotype of different alleles (Pp)
what is a phenotype?
describes what the organism looks like - e.g. for the bellflower, Pp & PP means the flower would be purple and pp means the flower would be white
what are punnet squares?
they are used to show breeding pairs and offspring - e.g. when clasping hands, left thumb on top is dominant over right thumb on top
make a punnet square and then check your answer for the following:
left thumb on top for parent 1 (AA)
right thumb on top for parent 2 (aa)
[ ] | A | A → genetic contribution of one parent
a | Aa | Aa }
a | Aa | Aa } offspring genotype possibilities
^ genetic contribution of the other parent
what is an allele?
a version of a gene; a person inherits two alleles for each gene, one coming from each parent
what is a dominant trait?
a characteristic that needs only one copy of an allele to appear in the physical appearance of an organism
what is a recessive trait?
a characteristic that is only expressed in the phenotype when two identical alleles are inherited
what are autosomal chromosomes?
all of the first 22 pairs of chromosomes - a chromosome that stores your genes, but not those that determine sex
what are sex chromosomes?
chromosomes that determine the sex of an organism
what is the genotype for the sex chromosomes in female?
XX
what is the genotype for the sex chromosome in males?
XY
what are the differences between autosomal and sex-linked traits?
autosomal traits exist in someone regardless of their sex (e.g. dimples and ear lobes). sex-linked traits exist in someone because of their sex (e.g. muscular dystrophy)
what does autosomal dominant mean in terms of inheritance?
an allele that will physically present with one of two copies in the genotype (GG or Gg)
what does autosomal recessive mean in terms of inheritance?
an allele that will only physically present with two copies in the genotype (gg)
what does it mean when something is X-linked dominant?
the dominant allele is on the X chromosome
what is does mean when something is X-linked recessive?
the recessive alleles are on both X chromosomes (< females; in males, the Y chromosome lets whatever the X allele is to be dominant - therefore, only one recessive allele is required)
a male’s phenotype will match whatever the allele on the X chromosome is for a specific trait. XR = normal eyesight, Xr = colourblind
therefore, what does XRY mean?
the male has normal eyesight
what are pedigrees?
family trees that show how a trait is passed down by studying genetic patterns
what are the symbols shown in pedigrees?
white square = male
white circle = female
shaded square = male, presence of trait
shaded circle = female, presence of trait
line drawn between two symbols = partners
what does the term 'genetic code' mean?
the sequence of nucleotides in DNA, inherited from parent organisms
what is transcription?
the process of copying the DNA that makes up a gene to messenger RNA
what is translation?
the formation of a protein from RNA
what is a codon?
a group of three nucleotides on mRNA
what is a mutation?
a permanent change in the sequence or amount of DNA
in the process of transcription, DNA gets copied into:
RNA
what are the types of mutations?
frameshift and point
in sex-linked inheritance, if a female has a heterozygous genotype for a trait this is called being a
carrier
a point mutation is a change to:
a single base
insertion is a type of point mutation where:
a base is added to a sequence
which types of point mutation can cause a frameshift?
insertion (addition of a base) and deletion (removal of a base)
a frameshift caused by a point mutation will result in the protein not functioning properly because
all amino acids after the changed base are likely to be different
if a sequence of bases in a gene is normally
AGUCACC
and a point mutation changes it to
AGCACCU
what type of mutation has occured?
deletion
what is one difference between DNA and RNA?
DNA is double stranded and RNA is single stranded
where does a cell build the proteins it needs?
in ribosomes in the cytoplasm
which of the following could be codons:
TCA, GCG, DNA or ATTGCATC
TCA and GCG
what are the building blocks of proteins?
amino acids
what is the outcome of transcription?
RNA molecule
Note
Flashcard